Gene Name | RIKEN cDNA 2410006H16 gene | Gene Symbol | 2410006H16Rik | |||
Chromosome | 11 | Genomic Location | chr11:62,416,350-62,418,350 | ![]() |
||
Synonyms | ||||||
Links |
UCSC Genome Browser(chr11:62,416,350-62,418,350) NCBI Gene(69221) IGTC(2410006H16Rik,23357) UNIGene(Mm.270874) |
MGI(1916471) KEGG GENES(mmu:) EST Profile(mm.270874) |
Other Clone Trapped This Gene |
---|
21-B6T17, 21-T20, 21-T36, 21-T210, 21-W125 |
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB545852 | GSS Location | chr11:62,416,437-62,416,784 | Size | 135 |
Sequence | GGCCTGCTGGTGACGGTNTGGAGCGATGTGAGCCCGGGCCCAGCCTNTCAGCTCCGCNTTGTGCG CTGCACAGAACTAGGGGAGCNTGACGGGACGTTGACAACGGGAATAGGAGCAGTATCATCCCACC ATGAG |
||||
Links |
UCSC Browser(chr11:62,416,437-62,416,784) IGTC(Ayu21-W263) |
[AK010427] Mus musculus ES cells cDNA, RIKEN full-length enriched library, clone:2410006H16 product:unclassifiable, full insert sequence. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for 2410006H16Rik) |