Gene Name | PHD finger protein 20 | Gene Symbol | Phf20 | |||
Chromosome | 2 | Genomic Location | chr2:156,020,000-156,137,000 | ![]() |
||
Synonyms | 6820402O20Rik | |||||
Links |
UCSC Genome Browser(chr2:156,020,000-156,137,000) NCBI Gene(228829) IGTC(Phf20,870) UNIGene(Mm.427078) |
MGI(2444148) KEGG GENES(mmu:228829) EST Profile(mm.427078) |
Other Clone Trapped This Gene |
---|
21-42, 21-W269, K13F05, 21-KBW263 |
Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB330873 | GSS Location | chr2:156,022,479-156,022,533 | Size | 55 |
Sequence | GCACAGTCCTTCTGTCGGTTGGTCTGGAGCGGCGCAGCAGGAGCGGGNCCGTGAG | ||||
Links |
UCSC Browser(chr2:156,022,479-156,022,533) IGTC() |
[AK045309] Mus musculus 9.5 days embryo parthenogenote cDNA, RIKEN full-length enriched library, clone:B130064I22 product:GLIOMA-EXPRESSED ANTIGEN 2 (FRAGMENT) homolog [Homo sapiens], full insert sequence. |
Card ID | 1067 | ||||
Strain Name | B6;CB-Phf20Gt(pU-21T)224Imeg | ||||
Internal Code | Ayu21-T224 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Phf20) |