ID 21-T224
Registered: 2007.06.29 Last update: 2018.06.01
| Gene Name | PHD finger protein 20 | Gene Symbol | Phf20 | |||
| Chromosome | 2 | Genomic Location | chr2:156,020,000-156,137,000 |  |
||
| Synonyms | 6820402O20Rik | |||||
| Links |
UCSC Genome Browser(chr2:156,020,000-156,137,000) NCBI Gene(228829) IGTC(Phf20,870) UNIGene(Mm.427078) |
MGI(2444148) KEGG GENES(mmu:228829) EST Profile(mm.427078) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-42, 21-W269, K13F05, 21-KBW263 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB330873 | GSS Location | chr2:156,022,479-156,022,533 | Size | 55 |
| Sequence | GCACAGTCCTTCTGTCGGTTGGTCTGGAGCGGCGCAGCAGGAGCGGGNCCGTGAG | ||||
| Links |
UCSC Browser(chr2:156,022,479-156,022,533) IGTC() |
||||
Homology Search Results
| [AK045309] Mus musculus 9.5 days embryo parthenogenote cDNA, RIKEN full-length enriched library, clone:B130064I22 product:GLIOMA-EXPRESSED ANTIGEN 2 (FRAGMENT) homolog [Homo sapiens], full insert sequence. |
Mouse Information
| Card ID | 1067 | ||||
| Strain Name | B6;CB-Phf20Gt(pU-21T)224Imeg | ||||
| Internal Code | Ayu21-T224 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Phf20) |
||||