ID 21-T248
Registered: 2007.06.13 Last update: 2018.06.03
| Gene Name | eukaryotic translation initiation factor 4B | Gene Symbol | Eif4b | |||
| Chromosome | 15 | Genomic Location | chr15:101,904,000-101,928,000 |  |
||
| Synonyms | 2310046H11Rik, C85189, Eif4a2, AL024095 | |||||
| Links |
UCSC Genome Browser(chr15:101,904,000-101,928,000) NCBI Gene(75705) IGTC(Eif4b,3888) UNIGene(Mm.290022) |
MGI(95304) KEGG GENES(mmu:75705) EST Profile(mm.290022) |
||||
| Other Clone Trapped This Gene |
|---|
| K6G02 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB325686 | GSS Location | chr15:101,904,365-101,912,529 | Size | 154 |
| Sequence | TCTCTCCCTCTCCCAACATGGCGGCCTCAGCAAAAAAGAAGAATAAGAAGGGGAAGACCATCTCC CTAACGGACTTTCTAGCTGAGGATGGAGGAACTGGTGGAGGAAGCACCTATGTCCCCCAAACCAG TCAGCTGGGCTGATGAAACAGACG |
||||
| Links |
UCSC Browser(chr15:101,904,365-101,912,529) IGTC(Ayu21-T248) |
||||
Homology Search Results
| [BY305328] BY305328 RIKEN full-length enriched mouse cDNA library, CD-1 Rathke's pouches 12.5 days embryo Mus musculus cDNA clone K920004E03 5', mRNA sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Eif4b) |
||||