ID K6G02

Registered: 2014.02.25   Last update: 2016.01.06
Gene Name eukaryotic translation initiation factor 4B Gene Symbol Eif4b
Chromosome 15 Genomic Location chr15:101,904,000-101,928,000
Synonyms Eif4a2
Links UCSC Genome Browser(chr15:101,904,000-101,928,000)
NCBI Gene(75705)
IGTC(Eif4b,3888)
UNIGene(Mm.290022)
 MGI(95304)
KEGG GENES(mmu:75705)
EST Profile(mm.290022)
Other Clone Trapped This Gene
21-T248
Trap Vector pCMT-SAhygpA-NP21 Cell Line vdR2-4 Method Splinkerette PCR
Accession AG999754 GSS Location chr15:101,921,058-101,921,202 Size 145
Sequence GAATTATTTCGCTGTTTTTTTCTGTAAGCTTGTATGCTATGGTCATATAGCATACAAACATAAAG
AATATAAGAATTGTTAGAAAAATATTTTTGTTTTCTTTGAGACAGGGTCTCTAGTTCTGGCTGTC
CGAAAACCAGAATGG
Links UCSC Browser(chr15:101,921,058-101,921,202)
IGTC(AyuK6G02)

Homology Search Results

Mouse Information

Card ID
Strain Name
Internal Code
Description This clone was isolated by using the gene trap vector pCMT-SAhygpA-NP21 and the ES cell line vdR2-4. Homozygous mutation was introduced at the vector insertion site by exploiting mitotic recombination induced with transient disruption of the Bloom’s syndrome gene. This double knock out ES cell line was established by Takeda Laboratory at Osaka University, and deposited to the EGTC. Please check Homozygous ES Cell Database. This sequence-tag is genomic sequence of 3'-flanking region obtained by Splinkerette PCR.
[Paper] "A homozygous mutant embryonic stem cell bank applicable for phenotype-driven genetic screening." Horie, K., Kokubu, C., Toshida, J., Akagi, K., Isotani, A., Oshitani, A., Yusa, K., Ikeda, R., Huang, Y., Bradley, A. and Takeda, J., Nature Methods, 8, 1071-1077 (2011). PubMed ID:22020066.
Links IMSR (for Eif4b)