ID 21-T264
Registered: 2007.07.13 Last update: 2018.06.05
| Gene Name | stathmin-like 2 | Gene Symbol | Stmn2 | |||
| Chromosome | 3 | Genomic Location | chr3:8,507,000-8,563,000 |  |
||
| Synonyms | SCG10; Stmb2; Scgn10; AI159727 | |||||
| Links |
UCSC Genome Browser(chr3:8,507,000-8,563,000) NCBI Gene(20257) IGTC(Stmn2,136) UNIGene(Mm.29580) |
MGI(98241) KEGG GENES(mmu:20257) EST Profile(mm.29580) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W47 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB332315 | GSS Location | chr3:8,509,537-8,509,630 | Size | 95 |
| Sequence | ACTCGCTCTCTCCGCGGCTACAGCTGGACCCTTCTCCTTTGCCTTCGCCACCACTCCGTGCGTGC ACATCCCTACAATGGCTAAAACAGCAATGG |
||||
| Links |
UCSC Browser(chr3:8,509,537-8,509,630) IGTC(Ayu21-T264) |
||||
Homology Search Results
| [AK149212] Mus musculus 2 days neonate sympathetic ganglion cDNA, RIKEN full-length enriched library, clone:7120494E19 product:stathmin-like 2, full insert sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Stmn2) |
||||