ID 21-W47
Registered: 2008.04.24 Last update: 2009.06.05
| Gene Name | stathmin-like 2 | Gene Symbol | Stmn2 | |||
| Chromosome | 3 | Genomic Location | chr3:8,507,000-8,563,000 |  |
||
| Synonyms | SCG10, Scgn10 | |||||
| Links |
UCSC Genome Browser(chr3:8,507,000-8,563,000) NCBI Gene(20257) IGTC(Stmn2,136) UNIGene(Mm.29580) |
MGI(98241) KEGG GENES(mmu:20257) EST Profile(mm.29580) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-T264 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB435092 | GSS Location | chr3:8,509,533-8,509,630 | Size | 92 |
| Sequence | CTCTCTCCCGCGGCTACAGCTGGACCCTTCTCCTTTGCCTTCGCCACCACTCCCGTGCGTGCACA TCCCTACAATGGCTAAAACAGCAATGG |
||||
| Links |
UCSC Browser(chr3:8,509,533-8,509,630) IGTC(Ayu21-W47) |
||||
Homology Search Results
| [AK149212] Mus musculus 2 days neonate sympathetic ganglion cDNA, RIKEN full-length enriched library, clone:7120494E19 product:stathmin-like 2, full insert sequence. |
Mouse Information
| Card ID | 1187 | ||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Stmn2) |
||||