| Gene Name | L1 repetitive element | Gene Symbol | L1 | |||
| Chromosome | Genomic Location | |||||
| Synonyms | ||||||
| Links |
UCSC Genome Browser() NCBI Gene() IGTC(L1,) UNIGene(Mm.) |
MGI() KEGG GENES(mmu:) EST Profile(mm.) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W75, 21-100, 21-KBW135, 21-B108, 21-T40, 21-B192, 21-W562, 21-T158, 21-B140, 21-T202, 21-T203, 21-T217, 21-T220, 21-T257, 21-T292, 21-T260, 21-T305, 21-T316, 21-T76, 21-T99, 21-T457, 21-T311, 21-T423, 21-T481, 21-W82, 21-W78, 21-W93, 21-W141, 21-W190, 21-W259, 21-W235, 21-W287, 21-KBW168, 21-T45, 21-W368, 21-W396, 21-W425, 21-W365, 21-W450, 21-W467, 21-W537, 21-W539, 21-W519, 21-KBW270, 21-KBW260, 21-MT95, 21-T999, 21-B179 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB330876 | GSS Location | Size | 116 | |
| Sequence | ACCTTCCGGACCGGAGGACAGGTGCCCACCCGGCTGGGGAGGCGGCTTAAGCCACAGCAGCAGCG GTCGCCATCTTGGTCCGGGACCCGCCGAACTTAGGAAATTAGTCTGAACAG |
||||
| Links |
UCSC Browser() IGTC(Ayu21-T298) |
||||
| [D84391] Mouse L1 repetitive element, complete sequence. |
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for L1) |
||||