Gene Name | L1 repetitive element | Gene Symbol | L1 | |||
Chromosome | Unlocalized | Genomic Location | Unlocalized | |||
Synonyms | ||||||
Links |
UCSC Genome Browser(Unlocalized) NCBI Gene() IGTC(L1,) UNIGene(Mm.) |
MGI() KEGG GENES(mmu:) EST Profile(mm.) |
Other Clone Trapped This Gene |
---|
21-W75, 21-100, 21-KBW135, 21-T40, 21-B192, 21-W562, 21-T158, 21-B140, 21-T298, 21-T202, 21-T203, 21-T217, 21-T220, 21-T257, 21-T292, 21-T260, 21-T305, 21-T316, 21-T76, 21-T99, 21-T457, 21-T311, 21-T423, 21-T481, 21-W82, 21-W78, 21-W93, 21-W141, 21-W190, 21-W259, 21-W235, 21-W287, 21-KBW168, 21-T45, 21-W368, 21-W396, 21-W425, 21-W365, 21-W450, 21-W467, 21-W537, 21-W539, 21-W519, 21-KBW270, 21-KBW260, 21-MT95, 21-T999, 21-B179 |
Trap Vector | pU-21B | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB256955 | GSS Location | Size | 142 | |
Sequence | CCTTTGTGGGCCGGGGACAGCCGGCCACCGTCCGAACCGGAGGACAGGTGCCCGCCCGGCTGGGG AGGCGGCCTAAGCCACAGCAGCAGCGGTCGCCATCTTGGTCCGAGACCCGCCGAACTTAGGAAAT TGGTCTGAACAG |
||||
Links |
UCSC Browser() IGTC(Ayu21-B108) |
[D84391] Mouse L1 repetitive element, complete sequence. |
Card ID | 629 | ||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21B, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for L1) |