ID 21-T301
Registered: 2008.02.19 Last update: 2008.02.19
| Gene Name | small nucleolar RNA host gene 3 | Gene Symbol | Snhg3 | |||
| Chromosome | 4 | Genomic Location | chr4:131,907,300-131,910,000 |  |
||
| Synonyms | Rnu17d, U17HG | |||||
| Links |
UCSC Genome Browser(chr4:131,907,300-131,910,000) NCBI Gene(399101) IGTC(Snhg3,590) UNIGene(Mm.84664) |
MGI(2684817) KEGG GENES(mmu:) EST Profile(mm.84664) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W529, 21-T53, 21-B193, 21-12, 21-T495, 21-T283, 21-W20, 21-W582 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB383669 | GSS Location | chr4:131,908,578-131,909,548 | Size | 73 |
| Sequence | CTCTCTAGGCGTCGCTCTCTTGGTGTGCTTGTTCTTGACCCGGTCAATGATTTCAGGTACTTTGT TGATGGAG |
||||
| Links |
UCSC Browser(chr4:131,908,578-131,909,548) IGTC(Ayu21-T301) |
||||
Homology Search Results
| [AJ006837] Mus musculus RNA transcript from U17 small nucleolar RNA host gene. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Snhg3) |
||||