Gene Name | small nucleolar RNA host gene 3 | Gene Symbol | Snhg3 | |||
Chromosome | 4 | Genomic Location | chr4:131,907,800-131,909,650 | ![]() |
||
Synonyms | Rnu17d, U17HG | |||||
Links |
UCSC Genome Browser(chr4:131,907,800-131,909,650) NCBI Gene(399101) IGTC(Snhg3,590) UNIGene(Mm.84664) |
MGI(2684817) KEGG GENES(mmu:) EST Profile(mm.84664) |
Other Clone Trapped This Gene |
---|
21-W529, 21-B193, 21-12, 21-T495, 21-T283, 21-T301, 21-W20, 21-W582 |
Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB265816 | GSS Location | chr4:131,908,578-131,909,596 | Size | 79 |
Sequence | CCGGGCTCTCTAGGCGTCGCTCTCTTGGTGTGCTTGTTCTTGACCCGGTCTAATGATTTCAGGTA CTTTGTTGATGGAG |
||||
Links |
UCSC Browser(chr4:131,908,578-131,909,596) IGTC(Ayu21-T53) |
[AJ006837] Mus musculus RNA transcript from U17 small nucleolar RNA host gene. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Snhg3) |