ID 21-T308
Registered: 2007.10.12 Last update: 2018.06.08
| Gene Name | calcium/calmodulin-dependent protein kinase kinase 2, beta | Gene Symbol | Camkk2 | |||
| Chromosome | 5 | Genomic Location | chr5:123,182,000-123,230,000 |  |
||
| Synonyms | 6330570N16Rik, mKIAA0787, AW061083 | |||||
| Links |
UCSC Genome Browser(chr5:123,182,000-123,230,000) NCBI Gene(207565) IGTC(Camkk2,5794) UNIGene(Mm.289237) |
MGI(2444812) KEGG GENES(mmu:207565) EST Profile(mm.289237) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-KBW214 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB363942 | GSS Location | chr5:123,229,261-123,229,362 | Size | 102 |
| Sequence | CTCCTCCCGTGGAGAGCCGAACCGGACCGAGCCGAGCCGAGCCAAGCCGAGCCAAGCCGAGCCGG GGGCGCAGAGCGCGGGAGGCGGCGGCGCGGAGCCCAG |
||||
| Links |
UCSC Browser(chr5:123,229,261-123,229,362) IGTC(Ayu21-T308) |
||||
Homology Search Results
| [AK032070] Mus musculus adult male medulla oblongata cDNA, RIKEN full-length enriched library, clone:6330570N16 product:CA+/CALMODULIN-DEPENDENT PROTEIN KINASE KINASE BETA (CAM-KINASE KINASE BETA) homolog [Rattus norvegicus], full insert sequence. |
Mouse Information
| Card ID | 1096 | ||||
| Strain Name | B6;CB-Camkk2Gt(pU-21T)308Imeg | ||||
| Internal Code | Ayu21-T308 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Camkk2) |
||||