Gene Name | calcium/calmodulin-dependent protein kinase kinase 2, beta | Gene Symbol | Camkk2 | |||
Chromosome | 5 | Genomic Location | chr5:123,182,000-123,230,000 | |||
Synonyms | 6330570N16Rik, mKIAA0787, AW061083 | |||||
Links |
UCSC Genome Browser(chr5:123,182,000-123,230,000) NCBI Gene(207565) IGTC(Camkk2,5794) UNIGene(Mm.289237) |
MGI(2444812) KEGG GENES(mmu:207565) EST Profile(mm.289237) |
Other Clone Trapped This Gene |
---|
21-KBW214 |
Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB363942 | GSS Location | chr5:123,229,261-123,229,362 | Size | 102 |
Sequence | CTCCTCCCGTGGAGAGCCGAACCGGACCGAGCCGAGCCGAGCCAAGCCGAGCCAAGCCGAGCCGG GGGCGCAGAGCGCGGGAGGCGGCGGCGCGGAGCCCAG |
||||
Links |
UCSC Browser(chr5:123,229,261-123,229,362) IGTC(Ayu21-T308) |
[AK032070] Mus musculus adult male medulla oblongata cDNA, RIKEN full-length enriched library, clone:6330570N16 product:CA+/CALMODULIN-DEPENDENT PROTEIN KINASE KINASE BETA (CAM-KINASE KINASE BETA) homolog [Rattus norvegicus], full insert sequence. |
Card ID | 1096 | ||||
Strain Name | B6;CB-Camkk2Gt(pU-21T)308Imeg | ||||
Internal Code | Ayu21-T308 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Camkk2) |