ID 21-KBW214
Registered: 2011.04.15 Last update: 2018.05.28
| Gene Name | calcium/calmodulin-dependent protein kinase kinase 2, beta | Gene Symbol | Camkk2 | |||
| Chromosome | 5 | Genomic Location | chr5:123,182,000-123,230,000 |  |
||
| Synonyms | 6330570N16Rik, mKIAA0787, AW061083 | |||||
| Links |
UCSC Genome Browser(chr5:123,182,000-123,230,000) NCBI Gene(207565) IGTC(Camkk2,5794) UNIGene(Mm.289237) |
MGI(2444812) KEGG GENES(mmu:207565) EST Profile(mm.289237) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-T308 |
| Trap Vector | pU-21W | Cell Line | KAB6 (Albino B6) | Method | 5'-RACE |
| Accession | AB624515 | GSS Location | chr5:123,229,261-123,229,334 | Size | 74 |
| Sequence | GAGCCGAGCCGAGCCAAGCCGAGCCAAGCCGAGCCGGGGGCGCAGAGCGCGGGAGGCGGCGGCGC GGAGCCCAG |
||||
| Links |
UCSC Browser(chr5:123,229,261-123,229,334) IGTC(Ayu21-KBW214) |
||||
Homology Search Results
| [AK032070] Mus musculus adult male medulla oblongata cDNA, RIKEN full-length enriched library, clone:6330570N16 product:CA+/CALMODULIN-DEPENDENT PROTEIN KINASE KINASE BETA (CAM-KINASE KINASE BETA) homolog [Rattus norvegicus], full insert sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Camkk2) |
||||