ID 21-T321
Registered: 2007.07.15 Last update: 2018.06.08
| Gene Name | MIER family member 2 | Gene Symbol | Mier2 | |||
| Chromosome | 10 | Genomic Location | chr10:79,002,500-79,018,000 |  |
||
| Synonyms | 2700087H15Rik, mKIAA1193 | |||||
| Links |
UCSC Genome Browser(chr10:79,002,500-79,018,000) NCBI Gene(70427) IGTC(Mier2,12605) UNIGene(Mm.334193) |
MGI(1917677) KEGG GENES(mmu:70427) EST Profile(mm.334193) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W49 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB332411 | GSS Location | chr10:79,017,819-79,017,861 | Size | 43 |
| Sequence | GCGCGGCCGCCGCCTCCCGCGCGCACGCTCGGCCATGGCGGAG | ||||
| Links |
UCSC Browser(chr10:79,017,819-79,017,861) IGTC(Ayu21-T321) |
||||
Homology Search Results
| [BY335511] LOCUS: BY335511, dbEST Id:16002027, EST name: BY335511, GenBank Acc: BY335511, GenBank gi: 26529508, CLONE INFO , Clone Id: L130044A22 (5') |
Mouse Information
| Card ID | 1168 | ||||
| Strain Name | B6,Cg-Mier2Gt(pU-21B)321Card | ||||
| Internal Code | Ayu21-T321 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Mier2) |
||||