Gene Name | MIER family member 2 | Gene Symbol | Mier2 | |||
Chromosome | 10 | Genomic Location | chr10:79,002,500-79,018,000 | |||
Synonyms | ||||||
Links |
UCSC Genome Browser(chr10:79,002,500-79,018,000) NCBI Gene(70427) IGTC(Mier2,12605) UNIGene(Mm.334193) |
MGI(1917677) KEGG GENES(mmu:70427) EST Profile(mm.334193) |
Other Clone Trapped This Gene |
---|
21-T321 |
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB441712 | GSS Location | chr10:79,017,819-79,017,866 | Size | 48 |
Sequence | GACCCGCGCGGCCGCCGCCTCCCGCGCGCACGCTCGGCCATGGCGGAG | ||||
Links |
UCSC Browser(chr10:79,017,819-79,017,866) IGTC(Ayu21-W49) |
[BY335511] LOCUS: BY335511, dbEST Id:16002027, EST name: BY335511, GenBank Acc: BY335511, GenBank gi: 26529508, CLONE INFO , Clone Id: L130044A22 (5') |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Mier2) |