ID 21-T327
Registered: 2007.08.10 Last update: 2018.06.11
| Gene Name | filamin binding LIM protein 1 | Gene Symbol | Fblim1 | |||
| Chromosome | 4 | Genomic Location | chr4:141,131,000-141,163,000 |  |
||
| Synonyms | 2410043F08Rik, Fblp1, migfilin, migfilin(s), Cal, Gt10 | |||||
| Links |
UCSC Genome Browser(chr4:141,131,000-141,163,000) NCBI Gene(74202) IGTC(Fblim1,1577) UNIGene(Mm.286536) |
MGI(1921452) KEGG GENES(mmu:74202) EST Profile(mm.286536) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-KBW66, 21-B6T19 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB354920 | GSS Location | chr4:141,151,810-141,155,799 | Size | 91 |
| Sequence | CAGCGCCGGCGGAGGCCGGGCGTGGGGAGCGCGGCAGTGGAGCTGGCCTGAACTTTGGACCTTGT CTTCCAGTAGGAAATCAGTCTCTCAG |
||||
| Links |
UCSC Browser(chr4:141,151,810-141,155,799) IGTC(Ayu21-T327) |
||||
Homology Search Results
| [X66903] M.musculus En-2/lacZ junction mRNA (Gt10). |
Mouse Information
| Card ID | 1108 | ||||
| Strain Name | B6;CB-Fblim1Gt(pU-21T)327Imeg | ||||
| Internal Code | Ayu21-T327 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Fblim1) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |