ID 21-KBW66
Registered: 2008.09.15 Last update: 2018.05.29
| Gene Name | filamin binding LIM protein 1 | Gene Symbol | Fblim1 | |||
| Chromosome | 4 | Genomic Location | chr4:141,131,000-141,163,000 |  |
||
| Synonyms | Fblp1, migfilin, migfilin(s), Cal, Gt10, 2410043F08Rik | |||||
| Links |
UCSC Genome Browser(chr4:141,131,000-141,163,000) NCBI Gene(74202) IGTC(Fblim1,1577) UNIGene(Mm.286536) |
MGI(1921452) KEGG GENES(mmu:74202) EST Profile(mm.286536) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-T327, 21-B6T19 |
| Trap Vector | pU-21W | Cell Line | KAB6 (Albino B6) | Method | 5'-RACE |
| Accession | AB453867 | GSS Location | chr4:141,151,810-141,155,801 | Size | 92 |
| Sequence | CGCAGCGCCGGCGGAGGCCGGGCGTGGGGAGCGCGGCAGTGGAGCTGGCCTGAACTTTGGACCTT GTCTTCCAGTAGGAAATCAGTACTCAG |
||||
| Links |
UCSC Browser(chr4:141,151,810-141,155,801) IGTC(Ayu21-KBW66) |
||||
Homology Search Results
| [X66903] M.musculus En-2/lacZ junction mRNA (Gt10). |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Fblim1) |
||||