ID 21-T329
Registered: 2007.06.28 Last update: 2018.06.11
| Gene Name | C-terminal binding protein 2 | Gene Symbol | Ctbp2 | |||
| Chromosome | 7 | Genomic Location | chr7:140,175,000-140,320,000 |  |
||
| Synonyms | Ribeye, D7Ertd45e, Gtrgeo6, AA407280 | |||||
| Links |
UCSC Genome Browser(chr7:140,175,000-140,320,000) NCBI Gene(13017) IGTC(Ctbp2,270) UNIGene(Mm.246240) |
MGI(1201686) KEGG GENES(mmu:13017) EST Profile(mm.246240) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W491, 21-T291, 21-T528, 21-W38, 21-W262, 21-W299, 21-W238, 21-W462, 21-W466 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB330744 | GSS Location | chr7:140,273,440-140,315,231 | Size | 146 |
| Sequence | GTGGGCGGCCCTTCTCCTTGGACGCCGGCGACCCAGGACGAGGGCTTCATCACTGTAAATGGTTG CAAGCCGACAAAGCTGCACCTCCTGAAAAAGACGGACAGCCCATCGCGTGAGCTGTAGAGTTTGT GGACGCATTTCTATCG |
||||
| Links |
UCSC Browser(chr7:140,273,440-140,315,231) IGTC(Ayu21-T329) |
||||
Homology Search Results
| [AB033123] Mus musculus CtBP2 mRNA for C-terminal binding protein 2, complete cds. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Ctbp2) |
||||