Gene Name | C-terminal binding protein 2 | Gene Symbol | Ctbp2 | |||
Chromosome | 7 | Genomic Location | chr7:140,150,000-140,350,000 | |||
Synonyms | Ribeye, D7Ertd45e, Gtrgeo6, AA407280 | |||||
Links |
UCSC Genome Browser(chr7:140,150,000-140,350,000) NCBI Gene(13017) IGTC(Ctbp2,270) UNIGene(Mm.246240) |
MGI(1201686) KEGG GENES(mmu:13017) EST Profile(mm.246240) |
Other Clone Trapped This Gene |
---|
21-T291, 21-T329, 21-T528, 21-W38, 21-W262, 21-W299, 21-W238, 21-W462, 21-W466 |
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | Ab572049 | GSS Location | chr7:140,314,824-140,314,937 | Size | 114 |
Sequence | ACCACCACCACCGCCGCCGCCGCCGGGTGGGGTGGGAGGGGCGGGAGCCACCGCTACCGCCGCCG CCTCCCGGGTGGGCGCCCTTCTCCTTGGACGCCGGCGACCCAGGACGAG |
||||
Links |
UCSC Browser(chr7:140,314,824-140,314,937) IGTC(Ayu21-W491) |
[AK146713] Mus musculus cDNA, RIKEN full-length enriched library, clone:I920046A10 product:C-terminal binding protein 2, full insert sequence. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Ctbp2) |