ID 21-T336
Registered: 2007.08.10 Last update: 2018.06.11
| Gene Name | recombination signal binding protein for immunoglobulin kappa J region | Gene Symbol | Rbpj | |||
| Chromosome | 5 | Genomic Location | chr5:53,945,000-54,050,000 |  |
||
| Synonyms | CBF,; RBP-J, RBPjk, Igkjrb, Rbpsuh, Igkrsbp, AI843960, RBP-Jkappa, RBP-J kappa | |||||
| Links |
UCSC Genome Browser(chr5:53,945,000-54,050,000) NCBI Gene(19664) IGTC(Rbpj,4038) UNIGene(Mm.209292) |
MGI(96522) KEGG GENES(mmu:19664) EST Profile(mm.209292) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W72 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB354922 | GSS Location | chr5:53,947,051-53,947,142 | Size | 92 |
| Sequence | CCACTCTGTAGCTCCGGCTGCTGTGGAATTTACAGCATAGCCCAGAACTCGAGGCGTCTGCTTAA CCCGGCTTCTCAAATGTTGGCCTATAG |
||||
| Links |
UCSC Browser(chr5:53,947,051-53,947,142) IGTC(Ayu21-T336) |
||||
Homology Search Results
| [BB839165] BB839165 RIKEN full-length enriched, 8 cells embryo Mus musculus cDNA clone E860008H06 5-, mRNA sequence gi|17039896|dbj|BB839165.1|[17039896] |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Rbpj) |
||||