ID 21-W72
Registered: 2008.04.30 Last update: 2009.06.05
| Gene Name | recombination signal binding protein for immunoglobulin kappa J region | Gene Symbol | Rbpj | |||
| Chromosome | 5 | Genomic Location | chr5:53,945,000-54,050,000 |  |
||
| Synonyms | CBF1, Igkjrb, RBPjk, RBP-J kappa, Rbpsuh, Igkrsbp | |||||
| Links |
UCSC Genome Browser(chr5:53,945,000-54,050,000) NCBI Gene(19664) IGTC(Rbpj,4038) UNIGene(Mm.209292) |
MGI(96522) KEGG GENES(mmu:19664) EST Profile(mm.209292) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-T336 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB435412 | GSS Location | chr5:53,947,087-53,947,142 | Size | 59 |
| Sequence | GATAGCCCAGAAACTCGAGGCGTCTGTCTTAACCCGGCTTCTCAAATGTTGGCCTAGAG | ||||
| Links |
UCSC Browser(chr5:53,947,087-53,947,142) IGTC(Ayu21-W72) |
||||
Homology Search Results
| [BB839165] BB839165 RIKEN full-length enriched, 8 cells embryo Mus musculus cDNA clone E860008H06 5-, mRNA sequence gi|17039896|dbj|BB839165.1|[17039896] |
Mouse Information
| Card ID | 1188 | ||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). TMouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Rbpj) |
||||