ID 21-T401
Registered: 2008.02.20 Last update: 2018.06.11
| Gene Name | cell adhesion molecule 1 | Gene Symbol | Cadm1 | |||
| Chromosome | 9 | Genomic Location | chr9:47,335,000-47,670,000 |  |
||
| Synonyms | 2900073G06Rik, 3100001I08Rik, Igsf4, Igsf4a, Necl2, RA175A, RA175B, RA175C, RA175N, SgIGSF, SynCam, Tslc1 | |||||
| Links |
UCSC Genome Browser(chr9:47,335,000-47,670,000) NCBI Gene(54725) IGTC(Cadm1,2862) UNIGene(Mm.234832) |
MGI(1889272) KEGG GENES(mmu:54725) EST Profile(mm.234832) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W34 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB383666 | GSS Location | chr9:47,338,466-47,338,588 | Size | 123 |
| Sequence | CTGTGCTGCCGAGCGGATCCCAGTGTGCGGCGGCAGCGGCTGTGGCGGCGGCGGCGGCGCCTCCA GGGCTCCGGCTCCGGCTCCTGCTGTTGCTCCTTTCGGCCGCGGCACTGATCCCCACAG |
||||
| Links |
UCSC Browser(chr9:47,338,466-47,338,588) IGTC(Ayu21-T401) |
||||
Homology Search Results
| [AF434663] Mus musculus tumor suprressor in lung cancer 1 mRNA, complete cds. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Cadm1) |
||||