ID 21-W34
Registered: 2008.04.24 Last update: 2012.03.24
| Gene Name | cell adhesion molecule 1 | Gene Symbol | Cadm1 | |||
| Chromosome | 9 | Genomic Location | chr9:47,335,000-47,670,000 |  |
||
| Synonyms | Igsf4a, SgIGSF, Necl2, Igsf4, Tslc1, RA175N, RA175B, RA175C, RA175A, SynCam | |||||
| Links |
UCSC Genome Browser(chr9:47,335,000-47,670,000) NCBI Gene(54725) IGTC(Cadm1,2862) UNIGene(Mm.234832) |
MGI(1889272) KEGG GENES(mmu:54725) EST Profile(mm.234832) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-T401 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB435089 | GSS Location | chr9:47,338,439-47,338,588 | Size | 155 |
| Sequence | CAGTATGAGGCAGGTGCCCGCACATGGCGAGTNCTGTGCTGCCGAGCGGATCCCAGTGTNCGGCG GCAGCGGCTGTGGCGGCGGCGGCGGCGCCTCCAGGGCTCCGGCTCCGGCTCCTGCTGTTGCTCCT TTCGGCCGCGGCACTATCCCCACAG |
||||
| Links |
UCSC Browser(chr9:47,338,439-47,338,588) IGTC(Ayu21-W34) |
||||
Homology Search Results
| [AF434663] Mus musculus tumor suprressor in lung cancer 1 mRNA, complete cds. |
Mouse Information
| Card ID | 1165 | ||||
| Strain Name | B6;CB-Cadm1Gt(pU-21W)34Imeg | ||||
| Internal Code | Ayu21-W34 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. [Paper] "IGSF4 is a novel TCR zeta-chain-interacting protein that enhances TCR-mediated signaling." Hye-Ran Kim, Byeong-Hun Jeon, Hyun-Su Lee, Sin-Hyeog Im, Masatake Araki, Kimi Araki, Ken-ichi Yamamura, Suck-Chei Choi, Do-Sim Park, and Chang-Duk Jun, J. Exp. Med., 208, 2545-2560 (2011).. PubMed ID:22084409. |
||||
| Links |
IMSR (for Cadm1) |
||||