ID 21-T408
Registered: 2007.11.30 Last update: 2018.06.11
| Gene Name | growth arrest specific 5 | Gene Symbol | Gas5 | |||
| Chromosome | 1 | Genomic Location | chr1:162,965,000-162,969,000 |  |
||
| Synonyms | Gas-5, Snhg2, Mir5117 | |||||
| Links |
UCSC Genome Browser(chr1:162,965,000-162,969,000) NCBI Gene(14455) IGTC(Gas5,2499) UNIGene(Mm.270065) |
MGI(95659) KEGG GENES(mmu:) EST Profile(mm.270065) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W41 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB370162 | GSS Location | chr1:162,965,297-162,965,935 | Size | 83 |
| Sequence | GCTTTCGGAGCTGTGCGGCATTCTGAGCAGGAATGGCAGTGTGGACCTCTGTGATGGGACATCTT GTGGGATCTCACAGCCAG |
||||
| Links |
UCSC Browser(chr1:162,965,297-162,965,935) IGTC(Ayu21-T408) |
||||
Homology Search Results
| [X59728] M.musculus mRNA for gas5 growth arrest specific protein. |
Mouse Information
| Card ID | 1129 | ||||
| Strain Name | B6;CB-Gas5Gt(pU-21T)408Imeg | ||||
| Internal Code | Ayu21-T408 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Gas5) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |