ID 21-W41
Registered: 2008.10.06 Last update: 2009.12.08
| Gene Name | growth arrest specific 5 | Gene Symbol | Gas5 | |||
| Chromosome | 1 | Genomic Location | chr1:162,965,000-162,969,000 |  |
||
| Synonyms | Gas-5, MGC6251 | |||||
| Links |
UCSC Genome Browser(chr1:162,965,000-162,969,000) NCBI Gene(14455) IGTC(Gas5,2499) UNIGene(Mm.270065) |
MGI(95659) KEGG GENES(mmu:) EST Profile(mm.270065) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-T408 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB462915 | GSS Location | chr1:162,965,297-162,965,325 | Size | 30 |
| Sequence | GCTTTCGGAGCTGTGCGGCATTCTGAGCAG | ||||
| Links |
UCSC Browser(chr1:162,965,297-162,965,325) IGTC(Ayu21-W41) |
||||
Homology Search Results
| [X59728] M.musculus mRNA for gas5 growth arrest specific protein. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Gas5) |
||||