ID 21-T460
Registered: 2007.11.02 Last update: 2018.06.12
| Gene Name | zinc finger protein 423 | Gene Symbol | Zfp423 | |||
| Chromosome | 8 | Genomic Location | chr8:90,185,000-90,490,000 |  |
||
| Synonyms | ataxia1, Ebfaz, mKIAA0760, Roaz, Zfp104, nur12, Znf423 | |||||
| Links |
UCSC Genome Browser(chr8:90,185,000-90,490,000) NCBI Gene(94187) IGTC(Zfp423,3201) UNIGene(Mm.23452) |
MGI(1891217) KEGG GENES(mmu:94187) EST Profile(mm.23452) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-KBW69, 21-W338, 21-W401 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB366557 | GSS Location | chr8:90,483,095-90,483,176 | Size | 82 |
| Sequence | GAGCCGACCGCGGACGGCGACGGAGCGCCCGGAGCCCCGGACATGTCCAGGCGGAAGCAGGCGAA GCCGCGATCGGTGAAAG |
||||
| Links |
UCSC Browser(chr8:90,483,095-90,483,176) IGTC(Ayu21-T460) |
||||
Homology Search Results
| [AY256893] Mus musculus early B-cell factor-associated zinc finger protein (Ebfaz) mRNA, complete cds, alternatively spliced. |
Mouse Information
| Card ID | 1266 | ||||
| Strain Name | B6;CB-Zfp423Gt(pU-21T)460Card | ||||
| Internal Code | Ayu21-T460 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Zfp423) |
||||