ID 21-W401
Registered: 2009.12.02 Last update: 2010.01.08
| Gene Name | zinc finger protein 423 | Gene Symbol | Zfp423 | |||
| Chromosome | 8 | Genomic Location | chr8:90,150,719-90,521,407 |  |
||
| Synonyms | Roaz, Ebfaz, nur12, Zfp104, ataxia1, mKIAA0760 | |||||
| Links |
UCSC Genome Browser(chr8:90,150,719-90,521,407) NCBI Gene(94187) IGTC(Zfp423,3201) UNIGene(Mm.23452) |
MGI(1891217) KEGG GENES(mmu:94187) EST Profile(mm.23452) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-T460, 21-KBW69, 21-W338 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB535727 | GSS Location | chr8:90,483,095-90,483,178 | Size | 84 |
| Sequence | GGGAGCCGACCGCGGACGGCGACGGAGCGCCCGGAGCCCCGGACATGTCCAGGCGGAAGCAGGCG AAGCCGCGATCGGTGAAAG |
||||
| Links |
UCSC Browser(chr8:90,483,095-90,483,178) IGTC(Ayu21-W401) |
||||
Homology Search Results
| [AY256893] Mus musculus early B-cell factor-associated zinc finger protein (Ebfaz) mRNA, complete cds, alternatively spliced. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Zfp423) |
||||