ID 21-T511
Registered: 2008.01.15 Last update: 2018.06.13
| Gene Name | protein inhibitor of activated STAT 2 | Gene Symbol | Pias2 | |||
| Chromosome | 18 | Genomic Location | chr18:77,275,000-77,395,000 |  |
||
| Synonyms | 6330408K17Rik, ARIP3, Dib, Miz1, PIASxalpha, PIASxb, PIASxbeta, SIZ2;, AI462206, AU018068 | |||||
| Links |
UCSC Genome Browser(chr18:77,275,000-77,395,000) NCBI Gene(17344) IGTC(Pias2,1119) UNIGene(Mm.6370) |
MGI(1096566) KEGG GENES(mmu:17344) EST Profile(mm.6370) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W71 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB375782 | GSS Location | chr18:77,277,630-77,277,720 | Size | 91 |
| Sequence | CGACAGTGGATGATGGGAACAGAACCCAGGCCTCTTCAAGAGCAGCAAGTGCTTCTAACTGCTGA GCCAGTTCTCCTGCCCTACTGACTAG |
||||
| Links |
UCSC Browser(chr18:77,277,630-77,277,720) IGTC(Ayu21-T511) |
||||
Homology Search Results
| [CF897127] A0220E01-5 NIA Mouse Embryonic Germ Cell cDNA Library (Long, subtracted) Mus musculus cDNA clone NIA:A0220E01 IMAGE:30730320 5-, mRNA sequence, gi|38164176|gb|CF897127.1|[38164176] |
Mouse Information
| Card ID | 1161 | ||||
| Strain Name | B6;CB-Pias2Gt(pU-21T)511Imeg | ||||
| Internal Code | Ayu21-T511 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Pias2) |
||||