ID 21-W71
Registered: 2008.06.19 Last update: 2009.06.05
| Gene Name | protein inhibitor of activated STAT 2 | Gene Symbol | Pias2 | |||
| Chromosome | 18 | Genomic Location | chr18:77,303,000-77,395,000 |  |
||
| Synonyms | Miz1, PIASxalpha, ARIP3, Dib, PIASxb, PIASxbeta | |||||
| Links |
UCSC Genome Browser(chr18:77,303,000-77,395,000) NCBI Gene(17344) IGTC(Pias2,1119) UNIGene(Mm.6370) |
MGI(1096566) KEGG GENES(mmu:17344) EST Profile(mm.6370) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-T511 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB441717 | GSS Location | chr18:77,303,979-77,304,158 | Size | 180 |
| Sequence | GTGGAGGTGTCGGCGCGGCGGCGGCGGCGGCGGCGGCGGCGGCCGCGGCGTCTAGAGCGGCGCCC AGTGCAGGATGTTGCAGGAGACGGCGGCGGTGTCGTTGGCGGCAGCGGGTGGAGGAGCGGCGACG GCTGAGGCGCCTGCGGGCGGGAGAAAATGGCGGATTTCGAGGAGTTGAGG |
||||
| Links |
UCSC Browser(chr18:77,303,979-77,304,158) IGTC(Ayu21-W71) |
||||
Homology Search Results
| [AK029716] Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4930503N10 product:Msx-interacting-zinc finger, full insert sequence. |
Mouse Information
| Card ID | 1197 | ||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Pias2) |
||||