ID 21-T519
Registered: 2008.01.15 Last update: 2018.06.13
| Gene Name | FRY like transcription coactivator | Gene Symbol | Fryl | |||
| Chromosome | 5 | Genomic Location | chr5:73,410,000-73,650,000 |  |
||
| Synonyms | 2310004H21Rik, 2510002A14Rik, 9030227G01Rik, mKIAA0826, 2010313D22Rik | |||||
| Links |
UCSC Genome Browser(chr5:73,410,000-73,650,000) NCBI Gene(72313) IGTC(Fryl,14831) UNIGene(Mm.260594) |
MGI(1919563) KEGG GENES(mmu:72313) EST Profile(mm.260594) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-KBW170, 21-T312, 21-KBW161, K12C03 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB375786 | GSS Location | chr5:73,647,639-73,647,868 | Size | 230 |
| Sequence | ATAGAAGGGGTGGGCAGAGCTCGCAGCACTGCCGGGCGCCCGTCGGGCTCTGGGAGAGACAGAAA TCCGGTTAAAATCAGAGTCGGAGGGAGGTTTAACCACGAATCGGTCCCGATCGGATTATTCCTTA AAGGGGACGCGCCATTGTCAAAGAGAACGGAGCCTGGGGCCCGAGGGCGGGGACCGGCGGCGCTG GAGGAACGAGGCAGCTGCACGGGACTGGGGACCTG |
||||
| Links |
UCSC Browser(chr5:73,647,639-73,647,868) IGTC(Ayu21-T519) |
||||
Homology Search Results
| [AK164590] Mus musculus 13 days embryo lung cDNA, RIKEN full-length enriched library, clone:D430021C24 product:Similar to DM61H21.1 homolog [Mus musculus], full insert sequence. |
Mouse Information
| Card ID | 1130 | ||||
| Strain Name | B6;CB-FrylGt(pU-21T)519Imeg | ||||
| Internal Code | Ayu21-T519 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Fryl) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |