ID K12C03

Registered: 2013.09.29   Last update: 2016.01.06
Gene Name FRY like transcription coactivator Gene Symbol Fryl
Chromosome 5 Genomic Location chr5:73,410,000-73,650,000
Synonyms mKIAA0826, 2010313D22Rik, 2310004H21Rik, 2510002A14Rik, 9030227G01Rik
Links UCSC Genome Browser(chr5:73,410,000-73,650,000)
NCBI Gene(72313)
IGTC(Fryl,14831)
UNIGene(Mm.260594)
 MGI(1919563)
KEGG GENES(mmu:72313)
EST Profile(mm.260594)
Other Clone Trapped This Gene
21-KBW170, 21-T519, 21-T312, 21-KBW161
Trap Vector pCMT-SAhygpA-NP21 Cell Line vdR2-4 Method Splinkerette PCR
Accession AB735712 GSS Location chr5:73,646,693-73,646,732 Size 40
Sequence CTAATGGGAGTTGTTGCTTCCGGGCGGCAGGTTCTCCCGG
Links UCSC Browser(chr5:73,646,693-73,646,732)
IGTC(AyuK12C03)

Homology Search Results

Mouse Information

Card ID
Strain Name
Internal Code
Description This clone was isolated by using the gene trap vector pCMT-SAhygpA-NP21 and the ES cell line vdR2-4. Homozygous mutation was introduced at the vector insertion site by exploiting mitotic recombination induced with transient disruption of the Bloom’s syndrome gene. This double knock out ES cell line was established by Takeda Laboratory at Osaka University, and deposited to the EGTC. Please check Homozygous ES Cell Database. This sequence-tag is genomic sequence of 3'-flanking region obtained by Splinkerette PCR.
[Paper] "A homozygous mutant embryonic stem cell bank applicable for phenotype-driven genetic screening." Horie, K., Kokubu, C., Toshida, J., Akagi, K., Isotani, A., Oshitani, A., Yusa, K., Ikeda, R., Huang, Y., Bradley, A. and Takeda, J., Nature Methods, 8, 1071-1077 (2011). PubMed ID:22020066.
Links IMSR (for Fryl)