ID 21-T532
Registered: 2008.01.18 Last update: 2018.06.13
| Gene Name | arginine glutamic acid dipeptide (RE) repeats | Gene Symbol | Rere | |||
| Chromosome | 4 | Genomic Location | chr4:149,650,000-150,000,000 |  |
||
| Synonyms | 1110033A15Rik, Atr2, atrophin-2, eye03, eyem03Jus, eyes3, mKIAA0458, ARG; ARP; DNB1, ATN1L, AI414665, AW742570, eye<m03Jus> | |||||
| Links |
UCSC Genome Browser(chr4:149,650,000-150,000,000) NCBI Gene(68703) IGTC(Rere,2778) UNIGene(Mm.291274) |
MGI(2683486) KEGG GENES(mmu:68703) EST Profile(mm.291274) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W27, 21-W33 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB378560 | GSS Location | chr4:149,944,323-149,944,405 | Size | 90 |
| Sequence | GAATCGGAGAAACGCTTCGTTAAGGGGCTCCGACAATACGGCAAGAACTTCTTCAGAATCAGAAA GGAGCTGCTTCCCAGTAAGGAAACC |
||||
| Links |
UCSC Browser(chr4:149,944,323-149,944,405) IGTC(Ayu21-T532) |
||||
Homology Search Results
| [CJ118740] CJ118740 RIKEN full-length enriched mouse cDNA library, C57BL/6J pooled tissue 11 Mus musculus cDNA clone M5C1077B12 5', mRNA sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Rere) |
||||