ID 21-W33
Registered: 2008.04.18 Last update: 2010.07.06
| Gene Name | arginine glutamic acid dipeptide (RE) repeats | Gene Symbol | Rere | |||
| Chromosome | 4 | Genomic Location | chr4:149,650,000-150,000,000 |  |
||
| Synonyms | ATN1L, Atr2, atrophin-2, DNB1 | |||||
| Links |
UCSC Genome Browser(chr4:149,650,000-150,000,000) NCBI Gene(68703) IGTC(Rere,2778) UNIGene(Mm.291274) |
MGI(2683486) KEGG GENES(mmu:68703) EST Profile(mm.291274) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-T532, 21-W27 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB434697 | GSS Location | chr4:149,656,068-149,656,184 | Size | 117 |
| Sequence | CCGCGCCCACCGCCCTCGGTCCGCCGCCGGCCCCCGCGGCCTCCCTCCCGGTCCCTGCACTTTCC CCGGAGCCCGGCCGCCACCCCTCTCATTGATGGTGTAGCGCCCGAGGGGAAG |
||||
| Links |
UCSC Browser(chr4:149,656,068-149,656,184) IGTC(Ayu21-W33) |
||||
Homology Search Results
| [CJ044727] CJ044727 RIKEN full-length enriched mouse cDNA library, C57BL/6J head 12 days embryo Mus musculus cDNA clone 3010070D20 5-, mRNA sequence, gi|75986297|dbj|CJ044727.1|[75986297] |
Mouse Information
| Card ID | 1532 | ||||
| Strain Name | B6;CB-RereGt(pU-21W)33Card | ||||
| Internal Code | Ayu21-W33 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Rere) |
||||