ID 21-T69
Registered: 2006.10.02 Last update: 2018.06.13
| Gene Name | ribosomal protein L27A | Gene Symbol | Rpl27a | |||
| Chromosome | 7 | Genomic Location | chr7:116,662,600-116,666,000 |  |
||
| Synonyms | L27', L27A, ribosomal protein L29 homolog (yeast) , L29 | |||||
| Links |
UCSC Genome Browser(chr7:116,662,600-116,666,000) NCBI Gene(26451) IGTC(Rpl27a,9) UNIGene(Mm.305750) |
MGI(1347076) KEGG GENES(mmu:26451) EST Profile(mm.305750) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W253 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB275896 | GSS Location | chr7:116,662,713-116,663,507 | Size | 164 |
| Sequence | TTTTCCCTTTCTGCCACCGCCATGCCATCCAGACTGAGGAAGACCCGGAAACTCCGGGGCCACGT GAGCCACGGCCACGGCCGCATCGGTAAGCACCGCAAGCACCCAGGCGGCCGCGGGAATGCTGGAG GCATGCACCACCACAGGATCAACTTTGACAAATA |
||||
| Links |
UCSC Browser(chr7:116,662,713-116,663,507) IGTC() |
||||
Homology Search Results
| [AK010286] Mus musculus ES cells cDNA, RIKEN full-length enriched library, clone:2400004P05 product:ribosomal protein L27a, full insert sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Rpl27a) |
||||