ID 21-W253
Registered: 2010.11.23 Last update: 2016.06.06
| Gene Name | ribosomal protein L27A | Gene Symbol | Rpl27a | |||
| Chromosome | 7 | Genomic Location | chr7:116,662,600-116,666,000 |  |
||
| Synonyms | ribosomal protein L29 homolog (yeast), L27A, L27' | |||||
| Links |
UCSC Genome Browser(chr7:116,662,600-116,666,000) NCBI Gene(26451) IGTC(Rpl27a,9) UNIGene(Mm.305750) |
MGI(1347076) KEGG GENES(mmu:26451) EST Profile(mm.305750) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-T69 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB601826 | GSS Location | chr7:116,663,098-116,663,507 | Size | 146 |
| Sequence | CCATGCCATCCAGACTGAGGAAGACCCGGAAATCCCGGGGCCACGTGAGCCACGGCCACGGGCCG CATCGGTAAGCACCGCAAGCACCCAGGCGGCCGCGGGAATGCTGGAGGCATGCACCACCACAGGA TCAACTTTGACAAATA |
||||
| Links |
UCSC Browser(chr7:116,663,098-116,663,507) IGTC(Ayu21-W253) |
||||
Homology Search Results
| [AK010286] Mus musculus ES cells cDNA, RIKEN full-length enriched library, clone:2400004P05 product:ribosomal protein L27a, full insert sequence. |
Mouse Information
| Card ID | 2384 | ||||
| Strain Name | B6.Cg-Rpl27aGt(pU-21W)253Card | ||||
| Internal Code | Ayu21-W253 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Rpl27a) |
||||