| Gene Name | par-3 family cell polarity regulator | Gene Symbol | Pard3 | |||
| Chromosome | 8 | Genomic Location | chr8:129,580,000-130,150,000 | |||
| Synonyms | ASIP, D8Ertd580e, Par3, PAR-3, Pard3a, Asip, Phip, Par-3, Pard-3;, AA960621, AI256638 | |||||
| Links |
UCSC Genome Browser(chr8:129,580,000-130,150,000) NCBI Gene(93742) IGTC(Pard3,7007) UNIGene(Mm.299254) |
MGI(2135608) KEGG GENES(mmu:93742) EST Profile(mm.299254) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W567 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB280747 | GSS Location | chr8:129,588,251-129,588,373 | Size | 123 |
| Sequence | GGCATGAAAGTGACCGTGTTCTTCGGGAGGACCCGGGTGTTCGTGCCGTGCGGAGATGGCCGCAT GAAAGTTTTCAGCCTCATCCAGCAGGCGGTGACCCGCTACCGGAAGGCCGTGGCCAAG |
||||
| Links |
UCSC Browser(chr8:129,588,251-129,588,373) IGTC(Ayu21-T79) |
||||
| [AK053576] Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched library clone:E130111L16 product:par-3 (partitioning defective 3) homolog (C. elegans), full insert sequence. |
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Pard3) |
||||