ID 21-W567
Registered: 2010.07.31 Last update: 2016.10.03
| Gene Name | par-3 family cell polarity regulator | Gene Symbol | Pard3 | |||
| Chromosome | 8 | Genomic Location | chr8:129,580,000-130,150,000 |  |
||
| Synonyms | PAR-3, D8Ertd580e, ASIP | |||||
| Links |
UCSC Genome Browser(chr8:129,580,000-130,150,000) NCBI Gene(93742) IGTC(Pard3,7007) UNIGene(Mm.299254) |
MGI(2135608) KEGG GENES(mmu:93742) EST Profile(mm.299254) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-T79 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB573689 | GSS Location | chr8:129,588,210-129,588,373 | Size | 164 |
| Sequence | CCGGCCCAGCGCCGCTCCGGCCACGGACAGCGAGGGACGGCGGCATGAAAGTGACCGTGTGCTTC GGGAGGACCCGGGTGGTCGTGCCGTGCGGAGATGGCCGCATGAAAGTTTTCAGCCTCATCCAGCA GGCGGTGACCCGCTACCGGAAGGCCGTGGCCAAG |
||||
| Links |
UCSC Browser(chr8:129,588,210-129,588,373) IGTC(Ayu21-W567) |
||||
Homology Search Results
| [NM_033620] Mus musculus par-3 (partitioning defective 3) homolog (C. elegans) (Pard3), transcript variant 3, mRNA. |
Mouse Information
| Card ID | 2396 | ||||
| Strain Name | B6;CB-Pard3Gt(pU-21W)567Card | ||||
| Internal Code | Ayu21-W567 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Pard3) |
||||