Gene Name | sorbin and SH3 domain containing 1 | Gene Symbol | Sorbs1 | |||
Chromosome | 19 | Genomic Location | chr19:40,360,000-40,600,000 | ![]() |
||
Synonyms | 2310065E01Rik, 9530001P15Rik, CAP, c-Cbl-associated protein, mKIAA1296, Ponsin, Sh3d5, SH3P12 | |||||
Links |
UCSC Genome Browser(chr19:40,360,000-40,600,000) NCBI Gene(20411) IGTC(Sorbs1,7220) UNIGene(Mm.210815) |
MGI(700014) KEGG GENES(mmu:20411) EST Profile(mm.210815) |
Other Clone Trapped This Gene |
---|
21-W254 |
Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB277856 | GSS Location | chr19:40,588,161-40,588,272 | Size | 112 |
Sequence | CCCAGTGTCGGTGAAGTCAGCTCGGAGTAGCAGAAAAACAGAGCGGGGCTGACTGTAGCGTGGAG CGCGAGCCGGGCTGGACGCGCGCAAGCCCTTGCCGGGGACCCGCGAG |
||||
Links |
UCSC Browser(chr19:40,588,161-40,588,272) IGTC(Ayu21-T86) |
[AK166943] Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched library, clone:I1C0024L01 product:sorbin and SH3 domain containing 1, full insert sequence. |
[BC012703] Mus musculus sorbin and SH3 domain containing 1, mRNA (cDNA clone MGC:13971 IMAGE:3602997), complete cds. |
Card ID | 869 | ||||
Strain Name | B6;CB-Sorbs1Gt(pU-21T)86Card | ||||
Internal Code | Ayu21-T86 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Sorbs1) |