ID 21-T86
Registered: 2006.10.12 Last update: 2018.06.14
| Gene Name | sorbin and SH3 domain containing 1 | Gene Symbol | Sorbs1 | |||
| Chromosome | 19 | Genomic Location | chr19:40,360,000-40,600,000 |  |
||
| Synonyms | 2310065E01Rik, 9530001P15Rik, CAP, c-Cbl-associated protein, mKIAA1296, Ponsin, Sh3d5, SH3P12 | |||||
| Links |
UCSC Genome Browser(chr19:40,360,000-40,600,000) NCBI Gene(20411) IGTC(Sorbs1,7220) UNIGene(Mm.210815) |
MGI(700014) KEGG GENES(mmu:20411) EST Profile(mm.210815) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W254 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB277856 | GSS Location | chr19:40,588,161-40,588,272 | Size | 112 |
| Sequence | CCCAGTGTCGGTGAAGTCAGCTCGGAGTAGCAGAAAAACAGAGCGGGGCTGACTGTAGCGTGGAG CGCGAGCCGGGCTGGACGCGCGCAAGCCCTTGCCGGGGACCCGCGAG |
||||
| Links |
UCSC Browser(chr19:40,588,161-40,588,272) IGTC(Ayu21-T86) |
||||
Homology Search Results
| [AK166943] Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched library, clone:I1C0024L01 product:sorbin and SH3 domain containing 1, full insert sequence. |
| [BC012703] Mus musculus sorbin and SH3 domain containing 1, mRNA (cDNA clone MGC:13971 IMAGE:3602997), complete cds. |
Mouse Information
| Card ID | 869 | ||||
| Strain Name | B6;CB-Sorbs1Gt(pU-21T)86Card | ||||
| Internal Code | Ayu21-T86 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Sorbs1) |
||||