ID 21-W254
Registered: 2009.03.26 Last update: 2018.09.05
| Gene Name | sorbin and SH3 domain containing 1 | Gene Symbol | Sorbs1 | |||
| Chromosome | 19 | Genomic Location | chr19:40,360,000-40,600,000 |  |
||
| Synonyms | 2310065E01Rik, 9530001P15Rik, CAP, c-Cbl-associated protein, mKIAA1296, Ponsin, Sh3d5 | |||||
| Links |
UCSC Genome Browser(chr19:40,360,000-40,600,000) NCBI Gene(20411) IGTC(Sorbs1,7220) UNIGene(Mm.210815) |
MGI(700014) KEGG GENES(mmu:20411) EST Profile(mm.210815) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-T86 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB491941 | GSS Location | chr19:40,588,161-40,588,259 | Size | 99 |
| Sequence | AAGTCAGCTCGGAGTAGCAGAAAAACAGAGCGGGGCTGACTGTAGCGTGGAGCGCGAGCCGGGCT GGACGCGCGCAAGCCCTTGCCGGGGACCCGCGAG |
||||
| Links |
UCSC Browser(chr19:40,588,161-40,588,259) IGTC(Ayu21-W254) |
||||
Homology Search Results
| [AK166943] Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched library, clone:I1C0024L01 product:sorbin and SH3 domain containing 1, full insert sequence. |
Mouse Information
| Card ID | 1460 | ||||
| Strain Name | B6;CB-Sorbs1Gt(pU-21W)254Card | ||||
| Internal Code | Ayu21-W254 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Sorbs1) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |