ID 21-W101
Registered: 2008.09.21 Last update: 2018.06.14
| Gene Name | spermatogenesis associated, serine-rich 2 | Gene Symbol | Spats2 | |||
| Chromosome | 15 | Genomic Location | chr15:98,956,000-99,045,000 |  |
||
| Synonyms | 2700012F11Rik, 59kDa, p59scr, Scr59, p59 | |||||
| Links |
UCSC Genome Browser(chr15:98,956,000-99,045,000) NCBI Gene(72572) IGTC(Spats2,12467) UNIGene(Mm.276650) |
MGI(1919822) KEGG GENES(mmu:72572) EST Profile(mm.276650) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-KBW94, 21-MT70 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB458546 | GSS Location | chr15:98,957,202-98,957,318 | Size | 118 |
| Sequence | GGAGGACGAGGGCGAGGAGGAGGCGGAGGCTCTTCTTTCCTCATCCCAGACCCGGGAGCGTCCGG AACGCAGAGCCCGGAACTGGGGGGACGCGGCGGCTGCAGGGAGCCCGGGCTAG |
||||
| Links |
UCSC Browser(chr15:98,957,202-98,957,318) IGTC(Ayu21-W101) |
||||
Homology Search Results
| [BC072579] Mus musculus spermatogenesis associated, serine-rich 2, mRNA (cDNA clone IMAGE:6416630). |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Spats2) |
||||