ID 21-W103
Registered: 2008.09.21 Last update: 2018.06.14
| Gene Name | polymerase (RNA) II (DNA directed) polypeptide F | Gene Symbol | Polr2f | |||
| Chromosome | 15 | Genomic Location | chr15:78,970,000-78,983,000 |  |
||
| Synonyms | 1810060D16Rik, RNA Pol II | |||||
| Links |
UCSC Genome Browser(chr15:78,970,000-78,983,000) NCBI Gene(69833) IGTC(Polr2f,4677) UNIGene(Mm.279861) |
MGI(1349393) KEGG GENES(mmu:69833) EST Profile(mm.279861) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB458548 | GSS Location | chr15:78,971,772-78,975,093 | Size | 164 |
| Sequence | GGCAAANTACGCGTGGTGCGGCGAGGGGCAAAGGCGCGCGTTCTCTGCTCTGCGCCCCGGGCGGA GAAGGCATCATGTCAGACAACGAGGACAATTTCGACGGCGACGACTTTGATGACGTTGAGGAGGA CGAAGGACTTGACGACTTGGAAAATGCTGAGGAG |
||||
| Links |
UCSC Browser(chr15:78,971,772-78,975,093) IGTC() |
||||
Homology Search Results
| [AK165600] Mus musculus B cells CRL-1669 BCL1 Clone 13.20-3B3 cDNA, RIKEN full-length enriched library, clone:G430042P11 product:DNA-directed RNA polymerase II 14.4 kDa polypeptide (EC 2.7.7.6) (RPB6) (RPB14.4) homolog [Rattus norvegicus], full insert sequence. |
Mouse Information
| Card ID | 1255 | ||||
| Strain Name | B6;CB-Polr2fGt(pU-21W)103Card | ||||
| Internal Code | Ayu21-W103 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Polr2f) |
||||