Gene Name | cyclin T1 | Gene Symbol | Ccnt1 | |||
Chromosome | 15 | Genomic Location | chr15:98,372,000-98,401,000 | ![]() |
||
Synonyms | 2810478G24Rik, CycT1, AI115585 | |||||
Links |
UCSC Genome Browser(chr15:98,372,000-98,401,000) NCBI Gene(12455) IGTC(Ccnt1,6061) UNIGene(Mm.86538) |
MGI(1328363) KEGG GENES(mmu:12455) EST Profile(mm.86538) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB458549 | GSS Location | chr15:98,395,478-98,398,011 | Size | 187 |
Sequence | GGAGAACAGCCCGTCGCGTCGCTTTGGCGTGGACTCCGATAAAGAACTCTCTTACCGCCAGCAGG CGGCCAATCTCCTCCAGGACATGGGACAACGTCTGAACGTCTCACAACTGACGATCAATACTGCT ATAGTATACATGCACCGATTCTACATGATTCAGTCTTTTACACAGTTTCATCGATAT |
||||
Links |
UCSC Browser(chr15:98,395,478-98,398,011) IGTC(Ayu21-W104) |
[AF113951] Mus musculus cyclin T mRNA, complete cds. |
Card ID | 1216 | ||||
Strain Name | B6;CB-Ccnt1Gt(pU-21W)104Card | ||||
Internal Code | Ayu21-W104 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Ccnt1) |