ID 21-W104
Registered: 2008.09.21 Last update: 2018.06.14
| Gene Name | cyclin T1 | Gene Symbol | Ccnt1 | |||
| Chromosome | 15 | Genomic Location | chr15:98,372,000-98,401,000 |  |
||
| Synonyms | 2810478G24Rik, CycT1, AI115585 | |||||
| Links |
UCSC Genome Browser(chr15:98,372,000-98,401,000) NCBI Gene(12455) IGTC(Ccnt1,6061) UNIGene(Mm.86538) |
MGI(1328363) KEGG GENES(mmu:12455) EST Profile(mm.86538) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB458549 | GSS Location | chr15:98,395,478-98,398,011 | Size | 187 |
| Sequence | GGAGAACAGCCCGTCGCGTCGCTTTGGCGTGGACTCCGATAAAGAACTCTCTTACCGCCAGCAGG CGGCCAATCTCCTCCAGGACATGGGACAACGTCTGAACGTCTCACAACTGACGATCAATACTGCT ATAGTATACATGCACCGATTCTACATGATTCAGTCTTTTACACAGTTTCATCGATAT |
||||
| Links |
UCSC Browser(chr15:98,395,478-98,398,011) IGTC(Ayu21-W104) |
||||
Homology Search Results
| [AF113951] Mus musculus cyclin T mRNA, complete cds. |
Mouse Information
| Card ID | 1216 | ||||
| Strain Name | B6;CB-Ccnt1Gt(pU-21W)104Card | ||||
| Internal Code | Ayu21-W104 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Ccnt1) |
||||