| Gene Name | amyloid beta (A4) precursor protein-binding, family B, member 2 | Gene Symbol | Apbb2 | |||
| Chromosome | 5 | Genomic Location | chr5:66,685,000-67,015,000 | |||
| Synonyms | 2310007D03Rik, FE65L1, Rirl1, TR2L, Zfra | |||||
| Links |
UCSC Genome Browser(chr5:66,685,000-67,015,000) NCBI Gene(11787) IGTC(Apbb2,9130) UNIGene(Mm.5159) |
MGI(108405) KEGG GENES(mmu:11787) EST Profile(mm.5159) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB470715 | GSS Location | chr5:66,986,203-66,986,292 | Size | 90 |
| Sequence | ACTCTGAATGCAGAGGGAGCGGAAAAGATGTCTCGGGTCCTGGTGGAGATTTGGGCGAGGCGGTT GGACTTGTGAGGCCGAGGCTTCCAG |
||||
| Links |
UCSC Browser(chr5:66,986,203-66,986,292) IGTC(Ayu21-W107) |
||||
| [AK084923] Mus musculus 13 days embryo lung cDNA, RIKEN full-length enriched library, clone:D430012G20 product:hypothetical protein, full insert sequence. |
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Apbb2) |
||||