ID 21-W117
Registered: 2008.11.05 Last update: 2018.06.14
| Gene Name | CWC22 spliceosome-associated protein | Gene Symbol | Cwc22 | |||
| Chromosome | 2 | Genomic Location | chr2:77,732,000-77,785,000 |  |
||
| Synonyms | MGC:7531, AA684037, AI173004, AL022752, mKIAA1604, B230213M24 | |||||
| Links |
UCSC Genome Browser(chr2:77,732,000-77,785,000) NCBI Gene(80744) IGTC(Cwc22,12661) UNIGene(Mm.288151) |
MGI(2136773) KEGG GENES(mmu:80744) EST Profile(mm.288151) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB469154 | GSS Location | chr2:77,784,207-77,784,245 | Size | 39 |
| Sequence | ACGCTCTTCCGGTATGATGGCGGCGCGGTGGAGCTTTAG | ||||
| Links |
UCSC Browser(chr2:77,784,207-77,784,245) IGTC(Ayu21-W117) |
||||
Homology Search Results
| [BC089523] Mus musculus cDNA sequence BC003993, mRNA (cDNA clone IMAGE:30504576), complete cds. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Cwc22) |
||||