ID 21-W118
Registered: 2009.01.15 Last update: 2018.06.14
| Gene Name | small nucleolar RNA host gene 7 | Gene Symbol | Snhg7 | |||
| Chromosome | 2 | Genomic Location | chr2:26,492,500-26,496,000 |  |
||
| Synonyms | 2610002F03Rik, AI427062 | |||||
| Links |
UCSC Genome Browser(chr2:26,492,500-26,496,000) NCBI Gene(72091) IGTC(Snhg7,) UNIGene(Mm.27103) |
MGI(1919341) KEGG GENES(mmu:) EST Profile(mm.27103) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-T535 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB477050 | GSS Location | chr2:26,494,950-26,495,764 | Size | 229 |
| Sequence | CTCTCGGCAGCCATGGCGGCTCTATGTTTGTATCGCCATTGTTACCGTTGGGACGCCGCGGATGA CCCTATATACCCTTGGCCGGCTACCGGGAAGACTGCGTCTCCTGACGATCGTAACGAAGATGTAC CGTGCTTTCCTTCTGAGAGTTTAGTCGCCCTAATATGTGCAGCAGGCTAACCGCGTGGAAGCTTG CCTGCCAGAAAGAAAGCGCCTGTTGGGCTATTAG |
||||
| Links |
UCSC Browser(chr2:26,494,950-26,495,764) IGTC(Ayu21-W118) |
||||
Homology Search Results
| [AK028166] Mus musculus ES cells cDNA, RIKEN full-length enriched library, clone:2410046H18 product:unclassifiable, full insert sequence. |
Mouse Information
| Card ID | 1252 | ||||
| Strain Name | B6;CB-Snhg7Gt(pU-21W)118Card | ||||
| Internal Code | Ayu21-W118 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Snhg7) |
||||