| Gene Name | solute carrier family 35, member B2 | Gene Symbol | Slc35b2 | |||
| Chromosome | 17 | Genomic Location | chr17:45,700,800-45,704,800 | |||
| Synonyms | 1110003M08Rik, PAPST1, Slc35b1, AA407792, AI842275 | |||||
| Links |
UCSC Genome Browser(chr17:45,700,800-45,704,800) NCBI Gene(73836) IGTC(Slc35b2,23205) UNIGene(Mm.289716) |
MGI(1921086) KEGG GENES(mmu:73836) EST Profile(mm.289716) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB467277 | GSS Location | chr17:45,700,904-45,701,017 | Size | 114 |
| Sequence | TGACTGGCTGGCTGCTGGAGCGGGCGGCAGAGGGAGCGGAGGGAGCGCGCGGCCCGGGGGACTCA CATTCCCCGGTCCCCCCTCCGCCCCACGCGGCTGGGCCATGGACGCCAG |
||||
| Links |
UCSC Browser(chr17:45,700,904-45,701,017) IGTC(Ayu21-W119) |
||||
| [AK155551] Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630322E07 product:solute carrier family 35, member B1, full insert sequence. |
| Card ID | 2017 | ||||
| Strain Name | B6;CB-Slc35b2Gt(pU-21W)119Card | ||||
| Internal Code | Ayu21-W119 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Slc35b2) |
||||
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |