ID 21-W121
Registered: 2008.09.21 Last update: 2018.06.14
| Gene Name | tet methylcytosine dioxygenase 2 | Gene Symbol | Tet2 | |||
| Chromosome | 3 | Genomic Location | chr3:133,125,000-133,209,000 |  |
||
| Synonyms | Ayu17-449, E130014J05Rik, mKIAA1546 tet methylcytosine dioxygenase 2 | |||||
| Links |
UCSC Genome Browser(chr3:133,125,000-133,209,000) NCBI Gene(214133) IGTC(Tet2,1663) UNIGene(Mm.347816) |
MGI(2443298) KEGG GENES(mmu:214133) EST Profile(mm.347816) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W40 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB458555 | GSS Location | chr3:133,207,164-133,207,258 | Size | 96 |
| Sequence | GGCAGGAGGAAGCAAGATGGCTGCCCTGTAGGATTTGTTAGAAAGGAGACCCGGCTGCGACGGCG GTGGACTGCGAGGCTGAGGGACCAGAACCAG |
||||
| Links |
UCSC Browser(chr3:133,207,164-133,207,258) IGTC(Ayu21-W121) |
||||
Homology Search Results
| [DQ079067] Mus musculus Ayu17-449 mRNA, complete cds. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Tet2) |
||||