ID 21-W122
Registered: 2008.09.21 Last update: 2018.06.14
| Gene Name | proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 | Gene Symbol | Psmd11 | |||
| Chromosome | 11 | Genomic Location | chr11:80,241,000-80,287,000 |  |
||
| Synonyms | 1700089D09Rik, 1810019E17Rik, 2610024G20Rik, 2810055C24Rik, C78232, P44.5, S9 | |||||
| Links |
UCSC Genome Browser(chr11:80,241,000-80,287,000) NCBI Gene(69077) IGTC(Psmd11,2216) UNIGene(Mm.260539) |
MGI(1916327) KEGG GENES(mmu:69077) EST Profile(mm.260539) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB458556 | GSS Location | chr11:80,242,123-80,242,257 | Size | 135 |
| Sequence | CCGGCGTCGGCGGCCGCGGCCGGGGACGGTGTGAGAGCGGTAAGATGGCGGCCGCAGCGGTGGTG GAGTTCCAGAGAGCCCAGTCTCTACTCAGCACCGACCGGGAGGCCTCCATCGACATCCTCCACTC CATCG |
||||
| Links |
UCSC Browser(chr11:80,242,123-80,242,257) IGTC(Ayu21-W122) |
||||
Homology Search Results
| [AK166950] Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched library, clone:I1C0025C22 product:proteasome (prosome, macropain) 26S subunit, non-ATPase, 11, full insert sequence. |
Mouse Information
| Card ID | 1778 | ||||
| Strain Name | B6;CB-<i>Psmd11<sup>Gt(pU-21W)122Card</sup></i> | ||||
| Internal Code | Ayu21-W122 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Psmd11) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |