| Gene Name | density-regulated protein | Gene Symbol | Denr | |||
| Chromosome | 5 | Genomic Location | chr5:124,356,000-124,380,000 | |||
| Synonyms | 1500003K04Rik | |||||
| Links |
UCSC Genome Browser(chr5:124,356,000-124,380,000) NCBI Gene(68184) IGTC(Denr,5919) UNIGene(Mm.28549) |
MGI(1915434) KEGG GENES(mmu:68184) EST Profile(mm.28549) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB468961 | GSS Location | chr5:124,357,265-124,358,223 | Size | 226 |
| Sequence | GCGAGCGCGCCCCAGCAGCGAATTTCGGGGCAGCCGTGGCCGGGAAGAGGAGTTGCATGTGTCGC TTCAGCTGGCGGGAGCGGAGGCGGCGGGGGCCGTGCGACCGGCTGGGTTTGTGAGATGGCTACTG ACATTTCTGAATCCAGCGGGGCGGATTGCAAAGGCGATACGAAGAACAGTGCCAAGTTAGATGCG GATTACCCTCTTCGAGTCCTTTATTGTGGAG |
||||
| Links |
UCSC Browser(chr5:124,357,265-124,358,223) IGTC(Ayu21-W123) |
||||
| [AK135127] Mus musculus 10 days neonate cerebellum cDNA, RIKEN full-length enriched library, clone:6530401I17 product:density-regulated protein, full insert sequence. |
| Card ID | 1217 | ||||
| Strain Name | B6;CB-DenrGt(pU-21W)123Card | ||||
| Internal Code | Ayu21-W123 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Denr) |
||||