ID 21-W148
Registered: 2008.10.04 Last update: 2018.06.15
| Gene Name | long non-coding RNA, embryonic stem cells expressed 1 | Gene Symbol | Lncenc1 | |||
| Chromosome | 13 | Genomic Location | chr13:98,203,390-98,268,682 |  |
||
| Synonyms | Gm11019, Gm2373, linc-Enc1, Lincenc1, Platr18 | |||||
| Links |
UCSC Genome Browser(chr13:98,203,390-98,268,682) NCBI Gene(1000039691) IGTC(Lncenc1,) UNIGene(Mm.) |
MGI(3780541) KEGG GENES(mmu:) EST Profile(mm.) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB462430 | GSS Location | chr13:98,252,712-98,252,987 | Size | 105 |
| Sequence | TGGAATGGAGACAGCAGAGAGCAGCTCGTCTGAGTTCAAGAGGGAAAGATATGGTGGCCAAGCAT GAGGTGCTCCACAAAGGCCGTGGGGGATTTGAAGCACGAG |
||||
| Links |
UCSC Browser(chr13:98,252,712-98,252,987) IGTC(Ayu21-W148) |
||||
Homology Search Results
| [BY736053] BY736053 RIKEN full-length enriched, blastocyst Mus musculus cDNA clone I1C0015N18 5-, mRNA sequence, gi|27149180|dbj|BY736053.1|[27149180] |
Mouse Information
| Card ID | 1286 | ||||
| Strain Name | B6,Cg-Gt(pU-21W)148Card | ||||
| Internal Code | Ayu21-W148 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Lncenc1) |
||||