Gene Name | long non-coding RNA, embryonic stem cells expressed 1 | Gene Symbol | Lncenc1 | |||
Chromosome | 13 | Genomic Location | chr13:98,203,390-98,268,682 | ![]() |
||
Synonyms | Gm11019, Gm2373, linc-Enc1, Lincenc1, Platr18 | |||||
Links |
UCSC Genome Browser(chr13:98,203,390-98,268,682) NCBI Gene(1000039691) IGTC(Lncenc1,) UNIGene(Mm.) |
MGI(3780541) KEGG GENES(mmu:) EST Profile(mm.) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB462430 | GSS Location | chr13:98,252,712-98,252,987 | Size | 105 |
Sequence | TGGAATGGAGACAGCAGAGAGCAGCTCGTCTGAGTTCAAGAGGGAAAGATATGGTGGCCAAGCAT GAGGTGCTCCACAAAGGCCGTGGGGGATTTGAAGCACGAG |
||||
Links |
UCSC Browser(chr13:98,252,712-98,252,987) IGTC(Ayu21-W148) |
[BY736053] BY736053 RIKEN full-length enriched, blastocyst Mus musculus cDNA clone I1C0015N18 5-, mRNA sequence, gi|27149180|dbj|BY736053.1|[27149180] |
Card ID | 1286 | ||||
Strain Name | B6,Cg-Gt(pU-21W)148Card | ||||
Internal Code | Ayu21-W148 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Lncenc1) |