ID 21-W149
Registered: 2008.10.04 Last update: 2018.06.15
| Gene Name | EEF1A alpha lysine methyltransferase 1 | Gene Symbol | Eef1akmt1 | |||
| Chromosome | 14 | Genomic Location | chr14:58,168,000-58,191,000 |  |
||
| Synonyms | 2510005D08Rik, Ayu21-96, GtAyu21-96, Gt(Ayu21)96Imeg, N6amt2, AW045965 | |||||
| Links |
UCSC Genome Browser(chr14:58,168,000-58,191,000) NCBI Gene(68043) IGTC(Eef1akmt1,19331) UNIGene(Mm.45225) |
MGI(1915293) KEGG GENES(mmu:68043) EST Profile(mm.45225) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-96 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB462431 | GSS Location | chr14:58,184,759-58,190,401 | Size | 186 |
| Sequence | GGACGACTGCGCATGCGTCAGTGGTCGCAGACACTTTGTGAAATGAGTGAGTCAGAAGACGACGA CATACCCCAGCTCTCTTCCCATACCTTAGCAGCTCTCCAGGAGTTTTATGCTGAGCAGAAGCAAT CCGTCAACCCCAGAGGGGATGATAAATATAACGTTGGGGTAATAGAGGAGAACTGG |
||||
| Links |
UCSC Browser(chr14:58,184,759-58,190,401) IGTC(Ayu21-W149) |
||||
Homology Search Results
| [AK012083] Mus musculus 10 days embryo whole body cDNA, RIKEN full-length enriched library, clone:2610509M16 product:hypothetical 2510005D08RIK ERP6-TFG2 CG9154 M142.5 /N-6 Adenine-specific DNA methylase containing protein, full insert sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Eef1akmt1) |
||||